Product Details

SNP ID: rs191297595
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:7640671 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGATGGGGGGTGGCTGGGAGGCCT[A/C]GGCAGCCAATGAGCCTAGGTGTGCA
Phenotype: MIM: 614770 MIM: 601717
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: PCP2 PubMed Links

Gene Details

Gene: PCP2
Gene Name: Purkinje cell protein 2

There are no transcripts associated with this gene.

Gene: PET100
Gene Name: PET100 homolog

There are no transcripts associated with this gene.

Gene: STXBP2
Gene Name: syntaxin binding protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001127396.2		Intron			NP_001120868.1
NM_001272034.1		Intron			NP_001258963.1
NM_006949.3		Intron			NP_008880.2
XM_011528210.1		Intron			XP_011526512.1
XM_011528212.2		Intron			XP_011526514.1

View Full Product Details