Product Details

SNP ID: rs35374298
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:48361616 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAATAGTTACATTGATGCCTAAATT[A/G]CCATTTTCTGCAAAAAGCTGTGCAA
Phenotype: MIM: 602212
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC100507577 PubMed Links

Gene Details

Gene: LOC100507577
Gene Name: uncharacterized LOC100507577

There are no transcripts associated with this gene.

Gene: LONP2
Gene Name: lon peptidase 2, peroxisomal

There are no transcripts associated with this gene.

Gene: SIAH1
Gene Name: siah E3 ubiquitin protein ligase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001006610.1	2446	Silent Mutation	GGC,GGT	G302G	NP_001006611.1
NM_003031.3	2446	Silent Mutation	GGC,GGT	G271G	NP_003022.3
XM_006721246.1	2446	Silent Mutation	GGC,GGT	G271G	XP_006721309.1
XM_011523279.1	2446	Silent Mutation	GGC,GGT	G271G	XP_011521581.1

View Full Product Details