Product Details

SNP ID: rs16978628
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:12701355 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CAGTCTCCATGATCACCTAGACCCC[A/G]TAGAAAGCCGCCAGCCTCTCCTTGA
Phenotype: MIM: 609074 MIM: 603002
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FBXW9 PubMed Links

Gene Details

Gene: FBXW9
Gene Name: F-box and WD repeat domain containing 9

There are no transcripts associated with this gene.

Gene: SNORD135
Gene Name: small nucleolar RNA, C/D box 135

There are no transcripts associated with this gene.

Gene: SNORD41
Gene Name: small nucleolar RNA, C/D box 41

There are no transcripts associated with this gene.

Gene: TNPO2
Gene Name: transportin 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001136195.1	2826	Silent Mutation	TAC,TAT	Y885Y	NP_001129667.1
NM_001136196.1	2826	Silent Mutation	TAC,TAT	Y895Y	NP_001129668.1
NM_013433.4	2826	Silent Mutation	TAC,TAT	Y885Y	NP_038461.2

View Full Product Details