Product Details

SNP ID: rs10141326
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.14:24240145 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TGGTAATGACGGAGCTGCACAGAGA[C/T]GGAGGACACACTGTAGGAGGGAAAC
Phenotype: MIM: 610781 MIM: 603171 MIM: 190195 MIM: 604319
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GMPR2 PubMed Links

Gene Details

Gene: GMPR2
Gene Name: guanosine monophosphate reductase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001002000.2	1014	Intron			NP_001002000.1
NM_001002001.2	1014	Intron			NP_001002001.1
NM_001002002.2	1014	Intron			NP_001002002.1
NM_001283021.1	1014	Intron			NP_001269950.1
NM_001283022.1	1014	Intron			NP_001269951.1
NM_001283023.1	1014	Intron			NP_001269952.1
NM_016576.4	1014	Intron			NP_057660.2
XM_005267740.3	1014	Intron			XP_005267797.1
XM_005267741.3	1014	Intron			XP_005267798.1
XM_005267742.3	1014	Intron			XP_005267799.1
XM_006720165.2	1014	Intron			XP_006720228.1
XM_017021356.1	1014	Intron			XP_016876845.1
XM_017021357.1	1014	Intron			XP_016876846.1
XM_017021358.1	1014	Intron			XP_016876847.1
XM_017021359.1	1014	Intron			XP_016876848.1
XM_017021360.1	1014	Intron			XP_016876849.1

Gene: NEDD8
Gene Name: neural precursor cell expressed, developmentally down-regulated 8

There are no transcripts associated with this gene.

Gene: NEDD8-MDP1
Gene Name: NEDD8-MDP1 readthrough

There are no transcripts associated with this gene.

Gene: TGM1
Gene Name: transglutaminase 1

There are no transcripts associated with this gene.

Gene: TINF2
Gene Name: TERF1 interacting nuclear factor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001099274.1	1014	Silent Mutation	CCA,CCG	P380P	NP_001092744.1
NM_012461.2	1014	UTR 3			NP_036593.2
XM_005267529.3	1014	Silent Mutation	CCA,CCG	P345P	XP_005267586.1
XM_011536642.2	1014	UTR 3			XP_011534944.1
XM_017021216.1	1014	Silent Mutation	CCA,CCG	P166P	XP_016876705.1
XM_017021217.1	1014	Silent Mutation	CCA,CCG	P166P	XP_016876706.1

View Full Product Details