Product Details

SNP ID: rs35445142
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:112160865 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGCATTGTGGGACGGAAGCCTGTC[C/T]TTTCTTCCTTTTGGTGCGAGCTTGC
Phenotype: MIM: 612141
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: EPB41L4A PubMed Links

Gene Details

Gene: EPB41L4A
Gene Name: erythrocyte membrane protein band 4.1 like 4A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022140.3		Intron			NP_071423.3
XM_011543530.1		Intron			XP_011541832.1
XM_011543531.2		Intron			XP_011541833.1
XM_011543532.1		Intron			XP_011541834.1
XM_011543533.1		Intron			XP_011541835.1
XM_017009689.1		Intron			XP_016865178.1

Gene: EPB41L4A-AS1
Gene Name: EPB41L4A antisense RNA 1

There are no transcripts associated with this gene.

Gene: SNORA13
Gene Name: small nucleolar RNA, H/ACA box 13

There are no transcripts associated with this gene.

View Full Product Details