Product Details

SNP ID: rs11702061
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:37067386 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTAATGCAACTGCCCAATATCTGCC[A/G]AAGAGAATATTAAAGTACATAATAG
Phenotype: MIM: 605938 MIM: 602259
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC105372795 PubMed Links

Gene Details

Gene: LOC105372795
Gene Name: uncharacterized LOC105372795

There are no transcripts associated with this gene.

Gene: PIGP
Gene Name: phosphatidylinositol glycan anchor biosynthesis class P

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320480.1		Intron			NP_001307409.1
NM_016430.3		Intron			NP_057514.2
NM_153681.2		Intron			NP_710148.1
NM_153682.2		Intron			NP_710149.1
XM_005260990.4		Intron			XP_005261047.1
XM_011529596.2		Intron			XP_011527898.1
XM_017028364.1		Intron			XP_016883853.1
XM_017028365.1		Intron			XP_016883854.1

Gene: TTC3
Gene Name: tetratricopeptide repeat domain 3

There are no transcripts associated with this gene.

View Full Product Details