Product Details

SNP ID: rs16994704
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:37065706 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTTCTTCTGCTGTTGATTTTTTGCA[C/T]AGTTATCTGTAAGAAAAGACCAAAA
Phenotype: MIM: 605938 MIM: 602259
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC105372795 PubMed Links

Gene Details

Gene: LOC105372795
Gene Name: uncharacterized LOC105372795

There are no transcripts associated with this gene.

Gene: PIGP
Gene Name: phosphatidylinositol glycan anchor biosynthesis class P

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320480.1	462	Missense Mutation			NP_001307409.1
NM_016430.3	462	Missense Mutation			NP_057514.2
NM_153681.2	462	Missense Mutation			NP_710148.1
NM_153682.2	462	Missense Mutation			NP_710149.1
XM_005260990.4	462	Intron			XP_005261047.1
XM_011529596.2	462	Missense Mutation			XP_011527898.1
XM_017028364.1	462	Missense Mutation			XP_016883853.1
XM_017028365.1	462	Missense Mutation			XP_016883854.1

Gene: TTC3
Gene Name: tetratricopeptide repeat domain 3

There are no transcripts associated with this gene.

View Full Product Details