Product Details

SNP ID: rs61729419
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:133407039 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCTCCCACTCCTTCTTCACCATGA[C/T]GTACAGCCTCATTGCTGCCTGGGCA
Phenotype: MIM: 604134 MIM: 602930
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ADAMTS13 PubMed Links

Gene Details

Gene: ADAMTS13
Gene Name: ADAM metallopeptidase with thrombospondin type 1 motif 13

There are no transcripts associated with this gene.

Gene: REXO4
Gene Name: REX4 homolog, 3'-5' exonuclease

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001279349.1	1118	Missense Mutation	ATC,GTC	I223V	NP_001266278.1
NM_001279350.1	1118	Missense Mutation	ATC,GTC	I258V	NP_001266279.1
NM_001279351.1	1118	Missense Mutation	ATC,GTC	I302V	NP_001266280.1
NM_020385.3	1118	Missense Mutation	ATC,GTC	I395V	NP_065118.2

Gene: STKLD1
Gene Name: serine/threonine kinase like domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153710.4	1118	Intron			NP_714921.4

View Full Product Details