Product Details

SNP ID: rs7862011
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:127733220 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTGAGAATGTCCAAAGGGAAATCAA[C/T]CAGGCGGAATGACAATGTCATCTCT
Phenotype: MIM: 604722 MIM: 608052
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: SH2D3C PubMed Links

Gene Details

Gene: SH2D3C
Gene Name: SH2 domain containing 3C

There are no transcripts associated with this gene.

Gene: TOR2A
Gene Name: torsin family 2 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001085347.2	837	Intron			NP_001078816.1
NM_001134430.2	837	Intron			NP_001127902.1
NM_001134431.2	837	UTR 3			NP_001127903.1
NM_001252018.1	837	Intron			NP_001238947.1
NM_001252021.1	837	Intron			NP_001238950.1
NM_001252023.1	837	Intron			NP_001238952.1
NM_130459.3	837	Missense Mutation			NP_569726.2
XM_011518554.1	837	Intron			XP_011516856.1

Gene: TTC16
Gene Name: tetratricopeptide repeat domain 16

There are no transcripts associated with this gene.

View Full Product Details