Product Details

SNP ID: rs76673715
Assay Type: Functionally tested
NCBI dbSNP Submissions: 15
Location: Chr.1:151286258 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTAGACATCTCAGTTTCTCCTCCTC[C/G]TTCCTGTTTTCATCAGGTCTGGGAT
Phenotype: MIM: 602758 MIM: 610568
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: LOC100507670 PubMed Links

Gene Details

Gene: LOC100507670
Gene Name: uncharacterized LOC100507670

There are no transcripts associated with this gene.

Gene: PI4KB
Gene Name: phosphatidylinositol 4-kinase beta

There are no transcripts associated with this gene.

Gene: ZNF687
Gene Name: zinc finger protein 687

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304763.1		Intron			NP_001291692.1
NM_001304764.1		Intron			NP_001291693.1
NM_020832.2		Intron			NP_065883.1
XM_005245366.3		Intron			XP_005245423.1
XM_011509811.2		Intron			XP_011508113.1
XM_011509812.2		Intron			XP_011508114.1
XM_011509813.2		Intron			XP_011508115.1

View Full Product Details