Product Details
- SNP ID
-
rs35103191
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:80262063 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GAGTTTTCTGGTCTGTGGTTCCCCA[G/T]TGTAGCATTGGAGAAGGAAACACTT
- Phenotype
-
MIM: 613768
MIM: 610117
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
RNF213
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs143410054] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- RNF213
- Gene Name
- ring finger protein 213
- Gene
- SLC26A11
- Gene Name
- solute carrier family 26 member 11
There are no transcripts associated with this gene.
View Full Product Details