Product Details
- SNP ID
-
rs9901806
- Assay Type
- Functionally tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:2056528 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTGGGCTCCCACTCCAGAGGGCAGC[C/T]GGTCCTTCGCCGGTGCCCAGGCCGC
- Phenotype
-
MIM: 603825
MIM: 610016
MIM: 613487
MIM: 610963
- Polymorphism
- C/T, Transition substitution
- Allele Nomenclature
-
- Literature Links
-
HIC1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs112963849] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- HIC1
- Gene Name
- hypermethylated in cancer 1
- Gene
- MIR132
- Gene Name
- microRNA 132
There are no transcripts associated with this gene.
- Gene
- MIR212
- Gene Name
- microRNA 212
There are no transcripts associated with this gene.
- Gene
- SMG6
- Gene Name
- SMG6, nonsense mediated mRNA decay factor
There are no transcripts associated with this gene.
View Full Product Details