Product Details

SNP ID: rs35544677
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100429331 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGGGGCGCCAGTTTCAGCACGTGCT[A/G]CCTCTACCCGCGCAAGCCCAAAAGG
Phenotype: MIM: 611478
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MEPCE PubMed Links

Gene Details

Gene: MEPCE
Gene Name: methylphosphate capping enzyme

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001194990.1	542	Intron			NP_001181919.1
NM_001194991.1	542	Intron			NP_001181920.1
NM_001194992.1	542	Intron			NP_001181921.1
NM_019606.5	542	Intron			NP_062552.2
XM_011516410.2	542	UTR 5			XP_011514712.1

Gene: PPP1R35
Gene Name: protein phosphatase 1 regulatory subunit 35

There are no transcripts associated with this gene.

Gene: ZCWPW1
Gene Name: zinc finger CW-type and PWWP domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001258008.1	542	Intron			NP_001244937.1
NM_017984.4	542	Intron			NP_060454.3
XM_005250479.2	542	Intron			XP_005250536.1
XM_005250480.2	542	Intron			XP_005250537.1
XM_006716035.3	542	Intron			XP_006716098.1
XM_006716036.2	542	Intron			XP_006716099.1
XM_006716037.3	542	Intron			XP_006716100.1
XM_006716038.3	542	Intron			XP_006716101.1
XM_006716040.3	542	Intron			XP_006716103.1
XM_017012379.1	542	Intron			XP_016867868.1
XM_017012380.1	542	Intron			XP_016867869.1

View Full Product Details