Product Details

SNP ID: rs3175191
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:79765348 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAGGCCACTGAGGAGAGCAGAGGC[A/G]GCGACAGTTTGGAGGCGGAGGTGAC
Phenotype: MIM: 602953
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HEY1 PubMed Links

Gene Details

Gene: HEY1
Gene Name: hes related family bHLH transcription factor with YRPW motif 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040708.1	697	Missense Mutation	CCG,CTG	P256L	NP_001035798.1
NM_001282851.1	697	Missense Mutation	CCG,CTG	P162L	NP_001269780.1
NM_012258.3	697	Missense Mutation	CCG,CTG	P252L	NP_036390.3

Gene: LINC01607
Gene Name: long intergenic non-protein coding RNA 1607

There are no transcripts associated with this gene.

Gene: LOC101927040
Gene Name: uncharacterized LOC101927040

There are no transcripts associated with this gene.

View Full Product Details