Product Details

SNP ID: rs3204447
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:50287900 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCATCCTGGGGGAGCAAGGCCTGA[A/G]AAAGGAAAGGAAGGGAAAGGCCCCC
Phenotype: MIM: 604038 MIM: 602725 MIM: 607073
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HYAL3 PubMed Links

Gene Details

Gene: HYAL3
Gene Name: hyaluronoglucosaminidase 3

There are no transcripts associated with this gene.

Gene: IFRD2
Gene Name: interferon related developmental regulator 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006764.4	1941	UTR 3			NP_006755.4

Gene: LSMEM2
Gene Name: leucine rich single-pass membrane protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304385.1	1941	UTR 3			NP_001291314.1
NM_153215.2	1941	UTR 3			NP_694947.1
XM_006712979.3	1941	UTR 3			XP_006713042.1
XM_006712980.3	1941	Intron			XP_006713043.1
XM_011533370.2	1941	UTR 3			XP_011531672.1

Gene: NAT6
Gene Name: N-acetyltransferase 6

There are no transcripts associated with this gene.

View Full Product Details