Product Details

SNP ID: rs3208320
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:12947964 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGAGTGACGATGTCCCTATCAGGGA[C/T]TATCGCATCGATGAGAAGAACTTTG
Phenotype: MIM: 109091 MIM: 605162 MIM: 600061
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CALR PubMed Links

Gene Details

Gene: CALR
Gene Name: calreticulin

There are no transcripts associated with this gene.

Gene: GADD45GIP1
Gene Name: GADD45G interacting protein 1

There are no transcripts associated with this gene.

Gene: MIR6515
Gene Name: microRNA 6515

There are no transcripts associated with this gene.

Gene: RAD23A
Gene Name: RAD23 homolog A, nucleotide excision repair protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270362.1	324	Silent Mutation	GAC,GAT	D63D	NP_001257291.1
NM_001270363.1	324	Silent Mutation	GAC,GAT	D63D	NP_001257292.1
NM_005053.3	324	Silent Mutation	GAC,GAT	D63D	NP_005044.1

View Full Product Details