Product Details

SNP ID: rs3741216
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:1995487 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCAGTGCAAATGACTTAGTGCAAAT[A/T]AAATTCAGAAGGGACGGGGGAAACA
Phenotype: MIM: 103280 MIM: 615509 MIM: 600789
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: H19 PubMed Links

Gene Details

Gene: H19
Gene Name: H19, imprinted maternally expressed transcript (non-protein coding)

There are no transcripts associated with this gene.

Gene: HOTS
Gene Name: H19 opposite tumor suppressor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001293171.2		Intron			NP_001280100.1

Gene: LINC01219
Gene Name: long intergenic non-protein coding RNA 1219

There are no transcripts associated with this gene.

Gene: MIR675
Gene Name: microRNA 675

There are no transcripts associated with this gene.

Gene: MRPL23
Gene Name: mitochondrial ribosomal protein L23

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021134.3		Intron			NP_066957.3
XM_006718271.2		Intron			XP_006718334.1
XM_011520273.1		Intron			XP_011518575.1
XM_011520275.2		Intron			XP_011518577.1
XM_011520276.2		Intron			XP_011518578.1

Gene: MRPL23-AS1
Gene Name: MRPL23 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details