Product Details

SNP ID: rs3766277
Assay Type: Functionally tested
NCBI dbSNP Submissions: 7
Location: Chr.1:37475826 on Build GRCh38
Set Membership: JSNP
Context Sequence [VIC/FAM]: CCTGCCCTCAGCTCCCTCTAGTCCC[A/G]CGGGGTGGTGGCACCCCTAAGGCTC
Phenotype: MIM: 610562
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LINC01137 PubMed Links

Gene Details

Gene: LINC01137
Gene Name: long intergenic non-protein coding RNA 1137

There are no transcripts associated with this gene.

Gene: MIR6732
Gene Name: microRNA 6732

There are no transcripts associated with this gene.

Gene: ZC3H12A
Gene Name: zinc finger CCCH-type containing 12A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001323550.1	480	Silent Mutation	CCA,CCG	P110P	NP_001310479.1
NM_001323551.1	480	UTR 5			NP_001310480.1
NM_025079.2	480	Silent Mutation	CCA,CCG	P110P	NP_079355.2
XM_011542198.2	480	Silent Mutation	CCA,CCG	P110P	XP_011540500.1

View Full Product Details