Product Details

SNP ID: rs72878797
Assay Type: Functionally tested
NCBI dbSNP Submissions: 16
Location: Chr.1:32364998 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGATGAGGACAAGGTACGTCCTCT[A/G]GACCTAGGCTATCCCCCTACCCTGT
Phenotype: MIM: 607660
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BSDC1 PubMed Links

Gene Details

Gene: BSDC1
Gene Name: BSD domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001143888.2	2679	UTR 3			NP_001137360.1
NM_001143889.2	2679	UTR 3			NP_001137361.1
NM_001143890.2	2679	UTR 3			NP_001137362.1
NM_001300958.1	2679	UTR 3			NP_001287887.1
NM_018045.7	2679	UTR 3			NP_060515.3
XM_005270986.4	2679	Intron			XP_005271043.1
XM_011541677.2	2679	Intron			XP_011539979.1

Gene: FAM229A
Gene Name: family with sequence similarity 229 member A

There are no transcripts associated with this gene.

Gene: TSSK3
Gene Name: testis specific serine kinase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_052841.3	2679	Intron			NP_443073.1

View Full Product Details