Product Details

SNP ID: rs7619423
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:126438587 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACCTGACTTCTCTTACTCAAAACTA[C/T]AGGCTCCCCTTATTCTAAACACATG
Phenotype: MIM: 615746
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CFAP100 PubMed Links

Gene Details

Gene: CFAP100
Gene Name: cilia and flagella associated protein 100

There are no transcripts associated with this gene.

Gene: LOC105374089
Gene Name: uncharacterized LOC105374089

There are no transcripts associated with this gene.

Gene: ZXDC
Gene Name: ZXD family zinc finger C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040653.3		Intron			NP_001035743.1
NM_025112.4		Intron			NP_079388.3
XM_005247757.3		Intron			XP_005247814.1
XM_006713741.2		Intron			XP_006713804.1
XM_011513119.2		Intron			XP_011511421.1

View Full Product Details