Product Details

SNP ID: rs6929124
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:159790007 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTAGGTTTAGTGTCTTTTCCTTGTC[C/T]CTGCTCGGGGAGCGTGAGGCAGATC
Phenotype: MIM: 611831 MIM: 186980
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MRPL18 PubMed Links

Gene Details

Gene: MRPL18
Gene Name: mitochondrial ribosomal protein L18

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318817.1		Intron			NP_001305746.1
NM_014161.4		Intron			NP_054880.2

Gene: PNLDC1
Gene Name: PARN like, ribonuclease domain containing 1

There are no transcripts associated with this gene.

Gene: SNORA20
Gene Name: small nucleolar RNA, H/ACA box 20

There are no transcripts associated with this gene.

Gene: SNORA29
Gene Name: small nucleolar RNA, H/ACA box 29

There are no transcripts associated with this gene.

Gene: TCP1
Gene Name: t-complex 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001008897.1		Intron			NP_001008897.1
NM_030752.2		Intron			NP_110379.2

View Full Product Details