Product Details

SNP ID: rs8008017
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24205859 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATACCCTAGCCTTCAGCAGCTCAAG[A/G]TGTTGGCCTTTGGATAGGAGGCTTC
Phenotype: MIM: 610051 MIM: 610711
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CHMP4A PubMed Links

Gene Details

Gene: CHMP4A
Gene Name: charged multivesicular body protein 4A

There are no transcripts associated with this gene.

Gene: MDP1
Gene Name: magnesium dependent phosphatase 1

There are no transcripts associated with this gene.

Gene: NEDD8-MDP1
Gene Name: NEDD8-MDP1 readthrough

There are no transcripts associated with this gene.

Gene: TSSK4
Gene Name: testis specific serine kinase 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001184739.1	140	UTR 5			NP_001171668.1
NM_001308067.1	140	Intron			NP_001294996.1
NM_174944.3	140	UTR 5			NP_777604.2
XM_011536663.2	140	Intron			XP_011534965.1
XM_017021226.1	140	UTR 5			XP_016876715.1

View Full Product Details