Product Details
- SNP ID
-
rs9608890
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.22:30359537 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGAACAGATACTCAGTCCTCATTTG[C/T]TGAATGCACACACAGCATCCAACCC
- Phenotype
-
MIM: 605595
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CCDC157
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs74930356] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CCDC157
- Gene Name
- coiled-coil domain containing 157
- Gene
- KIAA1656
- Gene Name
- KIAA1656 protein
There are no transcripts associated with this gene.
- Gene
- SF3A1
- Gene Name
- splicing factor 3a subunit 1
There are no transcripts associated with this gene.
View Full Product Details