Product Details

SNP ID: rs9843277
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:184250199 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGACCGGATTGCTCAGAGGACCGAG[A/T]TCAAGTCCTAGCGCTAATTGACTTG
Phenotype: MIM: 608750 MIM: 608721 MIM: 610145 MIM: 611620
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: ALG3 PubMed Links

Gene Details

Gene: ALG3
Gene Name: ALG3, alpha-1,3- mannosyltransferase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001006941.2		Intron			NP_001006942.1
NM_005787.5		Intron			NP_005778.1
XM_011512322.1		Intron			XP_011510624.1
XM_011512323.2		Intron			XP_011510625.1

Gene: CAMK2N2
Gene Name: calcium/calmodulin dependent protein kinase II inhibitor 2

There are no transcripts associated with this gene.

Gene: ECE2
Gene Name: endothelin converting enzyme 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001037324.2		Intron			NP_001032401.1
NM_001100120.1		Intron			NP_001093590.1
NM_001100121.1		Intron			NP_001093591.1
NM_014693.3		Intron			NP_055508.3
NM_032331.3		Intron			NP_115707.2

Gene: MIR1224
Gene Name: microRNA 1224

There are no transcripts associated with this gene.

Gene: VWA5B2
Gene Name: von Willebrand factor A domain containing 5B2

There are no transcripts associated with this gene.

View Full Product Details