Product Details

SNP ID: rs6060719
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:35958091 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTGTGGAAAAGAAGCTTGGATACTT[A/C]TTTTCTTTTTTATCAGAGCCATCAC
Phenotype: MIM: 610335 MIM: 610416
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CNBD2 PubMed Links

Gene Details

Gene: CNBD2
Gene Name: cyclic nucleotide binding domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001207076.2		Intron			NP_001194005.1
NM_001304367.1		Intron			NP_001291296.1
NM_080834.3		Intron			NP_543024.2
XM_005260295.2		Intron			XP_005260352.1
XM_011528590.2		Intron			XP_011526892.1
XM_011528592.1		Intron			XP_011526894.1
XM_011528593.2		Intron			XP_011526895.1
XM_011528598.1		Intron			XP_011526900.1
XM_017027683.1		Intron			XP_016883172.1

Gene: PHF20
Gene Name: PHD finger protein 20

There are no transcripts associated with this gene.

Gene: SCAND1
Gene Name: SCAN domain containing 1

There are no transcripts associated with this gene.

View Full Product Details