Product Details
- SNP ID
-
rs9877369
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.3:57298582 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTTATGTCAGAATTTTTGTTACTTA[C/T]AATGGAATCAATCCAAAGTGGTACA
- Phenotype
-
MIM: 603340
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ASB14
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs117336659] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ASB14
- Gene Name
- ankyrin repeat and SOCS box containing 14
There are no transcripts associated with this gene.
- Gene
- DNAH12
- Gene Name
- dynein axonemal heavy chain 12
View Full Product Details