Product Details

SNP ID: rs9450674
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.6:87411202 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATTTTAGTGAAACCTTGTTACTAAT[C/G]TCTTACATTGCAAACATTAACTAGT
Phenotype
Polymorphism: C/G, Transversion Substitution
Allele Nomenclature
Literature Links: CFAP206 PubMed Links
Additional Information: For this assay, SNP(s) [rs78489475] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001031743.2		Intron			NP_001026913.1