Product Details

SNP ID: rs11233520
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:83195529 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TATATAGATATCTCCCTTCTGGAAA[A/T]TTTCCTTGGGTACCTCAAGAGCAGC
Phenotype: MIM: 608876
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: ANKRD42 PubMed Links

Gene Details

Gene: ANKRD42
Gene Name: ankyrin repeat domain 42

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300972.1		Intron			NP_001287901.1
NM_001300973.1		Intron			NP_001287902.1
NM_001300975.1		Intron			NP_001287904.1
NM_001300976.1		Intron			NP_001287905.1
NM_001300977.1		Intron			NP_001287906.1
NM_182603.3		Intron			NP_872409.2

Gene: LOC100506282
Gene Name: uncharacterized LOC100506282

There are no transcripts associated with this gene.

Gene: PCF11
Gene Name: PCF11 cleavage and polyadenylation factor subunit

There are no transcripts associated with this gene.

Gene: PCF11-AS1
Gene Name: PCF11 anstisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details