Product Details

SNP ID: rs11054697
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:12119539 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGTCAGCCCTGATAGCTCAAGATG[C/T]AGCAGCCCCAGTACCATACATGACA
Phenotype: MIM: 603507
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC100506248 PubMed Links

Gene Details

Gene: LOC100506248
Gene Name: prothymosin alpha

There are no transcripts associated with this gene.

Gene: LRP6
Gene Name: LDL receptor related protein 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002336.2	6571	UTR 3			NP_002327.2
XM_006719078.3	6571	UTR 3			XP_006719141.1
XM_011520671.2	6571	UTR 3			XP_011518973.1
XM_017019304.1	6571	UTR 3			XP_016874793.1

Gene: MIR1244-4
Gene Name: microRNA 1244-4

There are no transcripts associated with this gene.

View Full Product Details