Product Details

SNP ID
rs6543089
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.2:101713988 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
ATTTCATTTACAATCTGGAACCTCA[G/T]ATGGCCTTATGACAAGAGCCAATAT
Phenotype
MIM: 604666
Polymorphism
G/T, Transversion Substitution
Allele Nomenclature
Literature Links
MAP4K4 PubMed Links
Additional Information
For this assay, SNP(s) [rs72383936] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
MAP4K4
Gene Name
mitogen-activated protein kinase kinase kinase kinase 4
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001242559.1 Intron NP_001229488.1
NM_001242560.1 Intron NP_001229489.1
NM_004834.4 Intron NP_004825.3
NM_145686.3 Intron NP_663719.2
NM_145687.3 Intron NP_663720.1
XM_005264048.2 Intron XP_005264105.1
XM_005264050.3 Intron XP_005264107.1
XM_005264052.3 Intron XP_005264109.1
XM_005264057.3 Intron XP_005264114.1
XM_005264058.3 Intron XP_005264115.1
XM_005264059.3 Intron XP_005264116.1
XM_005264060.3 Intron XP_005264117.1
XM_005264062.3 Intron XP_005264119.1
XM_005264063.3 Intron XP_005264120.1
XM_005264064.3 Intron XP_005264121.1
XM_005264065.3 Intron XP_005264122.1
XM_005264066.3 Intron XP_005264123.1
XM_005264068.3 Intron XP_005264125.1
XM_005264069.2 Intron XP_005264126.1
XM_005264071.2 Intron XP_005264128.1
XM_006712865.2 Intron XP_006712928.1
XM_006712868.2 Intron XP_006712931.1
XM_006712869.2 Intron XP_006712932.1
XM_017005349.1 Intron XP_016860838.1
XM_017005350.1 Intron XP_016860839.1
XM_017005351.1 Intron XP_016860840.1
XM_017005352.1 Intron XP_016860841.1
XM_017005353.1 Intron XP_016860842.1
XM_017005354.1 Intron XP_016860843.1
XM_017005355.1 Intron XP_016860844.1
XM_017005356.1 Intron XP_016860845.1
XM_017005357.1 Intron XP_016860846.1
XM_017005358.1 Intron XP_016860847.1
XM_017005359.1 Intron XP_016860848.1
XM_017005360.1 Intron XP_016860849.1
XM_017005361.1 Intron XP_016860850.1
XM_017005362.1 Intron XP_016860851.1
XM_017005363.1 Intron XP_016860852.1
XM_017005364.1 Intron XP_016860853.1
XM_017005365.1 Intron XP_016860854.1
XM_017005366.1 Intron XP_016860855.1
XM_017005367.1 Intron XP_016860856.1
XM_017005368.1 Intron XP_016860857.1
XM_017005369.1 Intron XP_016860858.1
XM_017005370.1 Intron XP_016860859.1
XM_017005371.1 Intron XP_016860860.1
XM_017005372.1 Intron XP_016860861.1
XM_017005373.1 Intron XP_016860862.1
XM_017005374.1 Intron XP_016860863.1
XM_017005375.1 Intron XP_016860864.1

View Full Product Details