Product Details

SNP ID: rs12979689
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49160532 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAGAAAGAAAAAAGTGATTTGAACA[A/G]CATGTGCAAAGTCCTTGCTAAGGAC
Phenotype: MIM: 142705 MIM: 603144 MIM: 606936
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HRC PubMed Links

Gene Details

Gene: HRC
Gene Name: histidine rich calcium binding protein

There are no transcripts associated with this gene.

Gene: PPFIA3
Gene Name: PTPRF interacting protein alpha 3

There are no transcripts associated with this gene.

Gene: TRPM4
Gene Name: transient receptor potential cation channel subfamily M member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195227.1		Intron			NP_001182156.1
NM_001321281.1		Intron			NP_001308210.1
NM_001321282.1		Intron			NP_001308211.1
NM_001321283.1		Intron			NP_001308212.1
NM_001321285.1		Intron			NP_001308214.1
NM_017636.3		Intron			NP_060106.2
XM_005259017.1		Intron			XP_005259074.1

View Full Product Details