Product Details

SNP ID: rs12154779
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:73689693 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAGAGGGATGAACGAGAGATTCCAC[A/G]GAAGATGGGGTTGAGTGTGGTTGCT
Phenotype: MIM: 186590 MIM: 615733
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DNAJC30 PubMed Links

Gene Details

Gene: DNAJC30
Gene Name: DnaJ heat shock protein family (Hsp40) member C30

There are no transcripts associated with this gene.

Gene: STX1A
Gene Name: syntaxin 1A

There are no transcripts associated with this gene.

Gene: WBSCR22
Gene Name: Williams-Beuren syndrome chromosome region 22

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001202560.2		Intron			NP_001189489.1
NM_017528.4		Intron			NP_059998.2
XM_006715847.1		Intron			XP_006715910.1
XM_011515778.1		Intron			XP_011514080.1
XM_011515779.1		Intron			XP_011514081.1

View Full Product Details