Product Details

SNP ID: rs11665815
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:1010904 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGTAGATCATGGAATGCTGCGGGA[A/G]GGAGAGTGGGAGTCAGGACGGGCCC
Phenotype: MIM: 606651 MIM: 611011
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GRIN3B PubMed Links

Gene Details

Gene: GRIN3B
Gene Name: glutamate ionotropic receptor NMDA type subunit 3B

There are no transcripts associated with this gene.

Gene: LOC105372235
Gene Name: uncharacterized LOC105372235

There are no transcripts associated with this gene.

Gene: TMEM259
Gene Name: transmembrane protein 259

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001033026.1		Intron			NP_001028198.1
NM_033420.3		Intron			NP_219488.1
XM_005259675.2		Intron			XP_005259732.1
XM_005259676.2		Intron			XP_005259733.1
XM_005259677.2		Intron			XP_005259734.1
XM_005259678.2		Intron			XP_005259735.1
XM_017027457.1		Intron			XP_016882946.1

View Full Product Details