Product Details

SNP ID: rs11171710
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:55974294 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGGGCCGGGCCCCGGCAGGCCTAAT[A/G]GGGGTCGCTGAGGAGGGGACTGGGC
Phenotype: MIM: 116953 MIM: 155550 MIM: 179514
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CDK2 PubMed Links

Gene Details

Gene: CDK2
Gene Name: cyclin dependent kinase 2

There are no transcripts associated with this gene.

Gene: PMEL
Gene Name: premelanosome protein

There are no transcripts associated with this gene.

Gene: RAB5B
Gene Name: RAB5B, member RAS oncogene family

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001252036.1	193	Intron			NP_001238965.1
NM_001252037.1	193	Intron			NP_001238966.1
NM_002868.3	193	Intron			NP_002859.1
XM_005269051.2	193	Intron			XP_005269108.1
XM_005269052.2	193	UTR 5			XP_005269109.1

View Full Product Details