Product Details

SNP ID
rs12946339
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.17:16032244 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
TTGACCTGCTACTAAAAATTAAACC[A/C]CAAAAACTAGAGATCCCTCTCCTGC
Phenotype
MIM: 600849 MIM: 613814
Polymorphism
A/C, Transversion Substitution
Allele Nomenclature
Literature Links
NCOR1 PubMed Links
Additional Information
For this assay, SNP(s) [rs112840784] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
NCOR1
Gene Name
nuclear receptor corepressor 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001190438.1 8756 Intron NP_001177367.1
NM_001190440.1 8756 UTR 3 NP_001177369.1
NM_006311.3 8756 UTR 3 NP_006302.2
XM_005256866.4 8756 UTR 3 XP_005256923.1
XM_005256868.4 8756 UTR 3 XP_005256925.1
XM_005256871.4 8756 UTR 3 XP_005256928.1
XM_005256872.4 8756 UTR 3 XP_005256929.1
XM_005256873.4 8756 UTR 3 XP_005256930.1
XM_005256874.4 8756 UTR 3 XP_005256931.1
XM_005256875.3 8756 UTR 3 XP_005256932.1
XM_006721601.3 8756 UTR 3 XP_006721664.1
XM_006721602.3 8756 UTR 3 XP_006721665.1
XM_006721603.3 8756 UTR 3 XP_006721666.1
XM_006721604.3 8756 UTR 3 XP_006721667.1
XM_011524083.2 8756 UTR 3 XP_011522385.1
XM_011524084.2 8756 UTR 3 XP_011522386.1
XM_011524085.2 8756 UTR 3 XP_011522387.1
XM_011524086.2 8756 UTR 3 XP_011522388.1
XM_017025396.1 8756 UTR 3 XP_016880885.1
XM_017025397.1 8756 UTR 3 XP_016880886.1
XM_017025398.1 8756 UTR 3 XP_016880887.1
XM_017025399.1 8756 UTR 3 XP_016880888.1
XM_017025400.1 8756 UTR 3 XP_016880889.1
XM_017025401.1 8756 UTR 3 XP_016880890.1
XM_017025402.1 8756 UTR 3 XP_016880891.1
XM_017025403.1 8756 UTR 3 XP_016880892.1
XM_017025404.1 8756 UTR 3 XP_016880893.1
XM_017025405.1 8756 UTR 3 XP_016880894.1
XM_017025406.1 8756 UTR 3 XP_016880895.1
XM_017025407.1 8756 UTR 3 XP_016880896.1
XM_017025408.1 8756 UTR 3 XP_016880897.1
XM_017025409.1 8756 UTR 3 XP_016880898.1
XM_017025410.1 8756 UTR 3 XP_016880899.1
XM_017025411.1 8756 UTR 3 XP_016880900.1
XM_017025412.1 8756 UTR 3 XP_016880901.1
XM_017025413.1 8756 UTR 3 XP_016880902.1
XM_017025414.1 8756 UTR 3 XP_016880903.1
XM_017025415.1 8756 UTR 3 XP_016880904.1
XM_017025416.1 8756 UTR 3 XP_016880905.1
XM_017025417.1 8756 UTR 3 XP_016880906.1
XM_017025418.1 8756 UTR 3 XP_016880907.1
XM_017025419.1 8756 UTR 3 XP_016880908.1
XM_017025420.1 8756 UTR 3 XP_016880909.1
Gene
TTC19
Gene Name
tetratricopeptide repeat domain 19
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001271420.1 8756 Intron NP_001258349.1
NM_017775.3 8756 Intron NP_060245.3
XM_017024801.1 8756 Intron XP_016880290.1
XM_017024802.1 8756 Intron XP_016880291.1

View Full Product Details