Product Details

SNP ID: rs4661203
Assay Type: Functionally tested
NCBI dbSNP Submissions: 21
Location: Chr.1:156603672 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTCCCAAAACTTAATGGCCATAAAT[A/C]TTTGAATCAAGATTCCTAGTCTGGC
Phenotype: MIM: 608862
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: GPATCH4 PubMed Links

Gene Details

Gene: GPATCH4
Gene Name: G-patch domain containing 4

There are no transcripts associated with this gene.

Gene: HAPLN2
Gene Name: hyaluronan and proteoglycan link protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021817.2		Intron			NP_068589.1
XM_005245415.2		Intron			XP_005245472.1
XM_011509853.2		Intron			XP_011508155.1
XM_017002020.1		Intron			XP_016857509.1
XM_017002021.1		Intron			XP_016857510.1

Gene: NAXE
Gene Name: NAD(P)HX epimerase

There are no transcripts associated with this gene.

View Full Product Details