Product Details
- SNP ID
-
rs7652518
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.3:170459973 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTAAATTTAGAATTTTCCCTTAGTA[G/T]CTTGATAAATCAATATATTGTCAAC
- Phenotype
-
MIM: 615720
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
LOC101928583
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs76139758] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LOC101928583
- Gene Name
- uncharacterized LOC101928583
There are no transcripts associated with this gene.
- Gene
- SLC7A14
- Gene Name
- solute carrier family 7 member 14
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_020949.2 |
9714 |
UTR 3 |
|
|
NP_066000.2 |
View Full Product Details