Product Details

SNP ID: rs11554754
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:14479458 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCCCGGGATCGGAGCCGCAGGGTC[A/C]CTCGGCCAGTGCCCAGTTGTGGGCC
Phenotype: MIM: 605072 MIM: 601032 MIM: 176802
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: GIPC1 PubMed Links

Gene Details

Gene: GIPC1
Gene Name: GIPC PDZ domain containing family member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005716.3	635	Missense Mutation	GGG,GTG	G241V	NP_005707.1
NM_202468.2	635	Missense Mutation	GGG,GTG	G241V	NP_974197.1
NM_202469.2	635	Missense Mutation	GGG,GTG	G144V	NP_974198.1
NM_202470.2	635	Missense Mutation	GGG,GTG	G241V	NP_974199.1
NM_202494.2	635	Missense Mutation	GGG,GTG	G144V	NP_974223.1
XM_017026147.1	635	Missense Mutation	GGG,GTG	G241V	XP_016881636.1
XM_017026148.1	635	Missense Mutation	GGG,GTG	G144V	XP_016881637.1

Gene: PKN1
Gene Name: protein kinase N1

There are no transcripts associated with this gene.

Gene: PTGER1
Gene Name: prostaglandin E receptor 1

There are no transcripts associated with this gene.

Gene: SNRPGP15
Gene Name: small nuclear ribonucleoprotein polypeptide G pseudogene 15

There are no transcripts associated with this gene.

View Full Product Details