Product Details

SNP ID: rs11549568
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:184338400 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTTCCTCTCAGTGTCCTCGGACCC[A/C]GCTTGGGCTGTGGAGTGGATCGAAC
Phenotype: MIM: 600570 MIM: 600495
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CLCN2 PubMed Links

Gene Details

Gene: CLCN2
Gene Name: chloride voltage-gated channel 2

There are no transcripts associated with this gene.

Gene: EIF4G1
Gene Name: eukaryotic translation initiation factor 4 gamma 1

There are no transcripts associated with this gene.

Gene: FAM131A
Gene Name: family with sequence similarity 131 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001171093.1	245	Intron			NP_001164564.1
NM_144635.4	245	Silent Mutation	CCA,CCC	P34P	NP_653236.3
XM_005247113.2	245	UTR 5			XP_005247170.1
XM_005247114.3	245	Intron			XP_005247171.1
XM_011512413.2	245	Intron			XP_011510715.1

View Full Product Details