Product Details

SNP ID: rs28446242
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:177502079 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CAGTAGAGGCTGGGAAGGAGATTGT[C/T]ATGAGGTAGGAGGAATAGCAAGTAA
Phenotype: MIM: 608170 MIM: 611435 MIM: 605903
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DDX41 PubMed Links

Gene Details

Gene: DDX41
Gene Name: DEAD-box helicase 41

There are no transcripts associated with this gene.

Gene: DOK3
Gene Name: docking protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001144875.1	2161	UTR 3			NP_001138347.1
NM_001144876.1	2161	UTR 3			NP_001138348.1
NM_001308235.1	2161	Intron			NP_001295164.1
NM_001308236.1	2161	Intron			NP_001295165.1
NM_024872.2	2161	Intron			NP_079148.2
XM_005265985.3	2161	UTR 3			XP_005266042.1
XM_005265987.1	2161	UTR 3			XP_005266044.1
XM_011534654.2	2161	UTR 3			XP_011532956.1
XM_011534655.2	2161	UTR 3			XP_011532957.1
XM_011534656.2	2161	UTR 3			XP_011532958.1
XM_011534657.2	2161	UTR 3			XP_011532959.1
XM_017009883.1	2161	UTR 3			XP_016865372.1
XM_017009884.1	2161	UTR 3			XP_016865373.1

Gene: PDLIM7
Gene Name: PDZ and LIM domain 7

There are no transcripts associated with this gene.

View Full Product Details