Product Details

SNP ID: rs11555543
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:22604833 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTTGTCCCCCCGGTGTCGCTGCCC[G/T]GGCCCGCAGGTGGGTTGGGGGGCCC
Phenotype: MIM: 607359 MIM: 609722
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: C8orf58 PubMed Links

Gene Details

Gene: C8orf58
Gene Name: chromosome 8 open reading frame 58

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013842.2	496	Intron			NP_001013864.1
NM_001198827.1	496	Intron			NP_001185756.1
NM_173686.2	496	Intron			NP_775957.2

Gene: CCAR2
Gene Name: cell cycle and apoptosis regulator 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021174.5	496	Intron			NP_066997.3
XM_011544603.1	496	UTR 5			XP_011542905.1
XM_011544604.1	496	UTR 5			XP_011542906.1
XM_017013717.1	496	Intron			XP_016869206.1

Gene: LOC107986876
Gene Name: proline-rich proteoglycan 2-like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017014122.1	496	Silent Mutation	AGG,CGG	R166R	XP_016869611.1

Gene: PDLIM2
Gene Name: PDZ and LIM domain 2

There are no transcripts associated with this gene.

View Full Product Details