Product Details

SNP ID: rs28659967
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:133366892 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AACACCAGAAAGTGGAGCCCTTGCC[A/G]TCATAAAGAATGGGCTGTTTCCCAC
Phenotype: MIM: 185630 MIM: 185660
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: STKLD1 PubMed Links

Gene Details

Gene: STKLD1
Gene Name: serine/threonine kinase like domain containing 1

There are no transcripts associated with this gene.

Gene: SURF2
Gene Name: surfeit 2

There are no transcripts associated with this gene.

Gene: SURF4
Gene Name: surfeit 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001280788.1		Intron			NP_001267717.1
NM_001280789.1		Intron			NP_001267718.1
NM_001280790.1		Intron			NP_001267719.1
NM_001280791.1		Intron			NP_001267720.1
NM_001280792.1		Intron			NP_001267721.1
NM_001280793.1		Intron			NP_001267722.1
NM_033161.3		Intron			NP_149351.1
XM_011518943.1		Intron			XP_011517245.1
XM_011518944.2		Intron			XP_011517246.1
XM_011518945.2		Intron			XP_011517247.1
XM_017015062.1		Intron			XP_016870551.1

View Full Product Details