Product Details

SNP ID: rs28502216
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:133462428 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCATGAAGCAGTCCCATTGCAGTT[C/T]GGCTCACTTTATCTGGCTTCTTTGC
Phenotype: MIM: 604134 MIM: 613104 MIM: 606813
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ADAMTS13 PubMed Links

Gene Details

Gene: ADAMTS13
Gene Name: ADAM metallopeptidase with thrombospondin type 1 motif 13

There are no transcripts associated with this gene.

Gene: CACFD1
Gene Name: calcium channel flower domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135775.2		Intron			NP_001129247.1
NM_001242369.1		Intron			NP_001229298.1
NM_001242370.1		Intron			NP_001229299.1
NM_017586.3		Intron			NP_060056.1
XM_011518181.2		Intron			XP_011516483.1
XM_011518182.1		Intron			XP_011516484.1
XM_011518184.1		Intron			XP_011516486.1
XM_011518185.2		Intron			XP_011516487.1
XM_011518186.1		Intron			XP_011516488.1

Gene: SLC2A6
Gene Name: solute carrier family 2 member 6

There are no transcripts associated with this gene.

View Full Product Details