Product Details
- SNP ID
-
rs61910724
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:4999001 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGTCACTATGGGAGACTGGAATAAC[A/C]GTGATGCTGTGGAGCCCATATTTAT
- Phenotype
-
MIM: 605470
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
MMP26
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs141806275] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MMP26
- Gene Name
- matrix metallopeptidase 26
There are no transcripts associated with this gene.
- Gene
- OR51L1
- Gene Name
- olfactory receptor family 51 subfamily L member 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001004755.1 |
19 |
Missense Mutation |
AGT,CGT |
S7R |
NP_001004755.1 |
View Full Product Details