Product Details

SNP ID: rs61736518
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:55651346 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGGGGGACAGCCGTGGTGGGGCTG[C/G]GGGCGAGGCCTCGGACCCTGAGTCA
Phenotype: MIM: 613478 MIM: 191318
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CCDC106 PubMed Links

Gene Details

Gene: CCDC106
Gene Name: coiled-coil domain containing 106

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013301.2	731	Missense Mutation	GCG,GGG	A126G	NP_037433.2
XM_005258827.2	731	Missense Mutation	GCG,GGG	A126G	XP_005258884.1
XM_005258828.2	731	Missense Mutation	GCG,GGG	A126G	XP_005258885.1

Gene: U2AF2
Gene Name: U2 small nuclear RNA auxiliary factor 2

There are no transcripts associated with this gene.

Gene: ZNF580
Gene Name: zinc finger protein 580

There are no transcripts associated with this gene.

Gene: ZNF581
Gene Name: zinc finger protein 581

There are no transcripts associated with this gene.

View Full Product Details