Product Details

SNP ID: rs80338842
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:112086910 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACCTTGAGCCCTCAGGAACGAGAT[C/G]GCGGTTCTCTGGAGGCTGAGTGCCG
Phenotype: MIM: 602690 MIM: 606659
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: C11orf57 PubMed Links

Gene Details

Gene: C11orf57
Gene Name: chromosome 11 open reading frame 57

There are no transcripts associated with this gene.

Gene: SDHD
Gene Name: succinate dehydrogenase complex subunit D

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001276503.1		Intron			NP_001263432.1
NM_001276504.1		Intron			NP_001263433.1
NM_001276506.1		Intron			NP_001263435.1
NM_003002.3		Intron			NP_002993.1

Gene: TIMM8B
Gene Name: translocase of inner mitochondrial membrane 8 homolog B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_012459.2		Intron			NP_036591.2

View Full Product Details