Product Details

SNP ID: rs41284374
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:116673844 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TAGGGAGATGAAGGTGAGTGGGAAG[A/G]AGGGGGTTAATTTAAAATCTGTCTG
Phenotype: MIM: 610701
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C10orf82 PubMed Links

Gene Details

Gene: C10orf82
Gene Name: chromosome 10 open reading frame 82

There are no transcripts associated with this gene.

Gene: HSPA12A
Gene Name: heat shock protein family A (Hsp70) member 12A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025015.2	2792	UTR 3			NP_079291.2
XM_005269672.3	2792	UTR 3			XP_005269729.1
XM_005269673.4	2792	UTR 3			XP_005269730.1
XM_011539579.2	2792	UTR 3			XP_011537881.1
XM_011539580.2	2792	UTR 3			XP_011537882.1
XM_017016032.1	2792	UTR 3			XP_016871521.1

Gene: LOC105378499
Gene Name: uncharacterized LOC105378499

There are no transcripts associated with this gene.

View Full Product Details