Product Details

SNP ID: rs62635764
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:44908143 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCTGACACAGACTTGGTGTCCAGG[A/C]TGGTTTCTGCAGATGTGGGGAGAGG
Phenotype: MIM: 614677 MIM: 603892 MIM: 137780
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CCDC103 PubMed Links

Gene Details

Gene: CCDC103
Gene Name: coiled-coil domain containing 103

There are no transcripts associated with this gene.

Gene: EFTUD2
Gene Name: elongation factor Tu GTP binding domain containing 2

There are no transcripts associated with this gene.

Gene: GFAP
Gene Name: glial fibrillary acidic protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001131019.2	1315	Intron			NP_001124491.1
NM_001242376.1	1315	Intron			NP_001229305.1
NM_002055.4	1315	Missense Mutation	AGC,ATC	S393I	NP_002046.1
XM_017024451.1	1315	Missense Mutation	AGC,ATC	S433I	XP_016879940.1

View Full Product Details