Product Details

SNP ID: hCV89435142
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49683944 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCCGCAGTGGTGACCATCATCAAG[C/G]GGAAGGTGGAGGAGGTGGAGCTCCC
Phenotype: MIM: 608846 MIM: 602950
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ADM5 PubMed Links

Gene Details

Gene: ADM5
Gene Name: adrenomedullin 5 (putative)

There are no transcripts associated with this gene.

Gene: CPT1C
Gene Name: carnitine palmitoyltransferase 1C

There are no transcripts associated with this gene.

Gene: MIR5088
Gene Name: microRNA 5088

There are no transcripts associated with this gene.

Gene: PRMT1
Gene Name: protein arginine methyltransferase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001207042.2	559	Missense Mutation	CGG,GGG	R126G	NP_001193971.1
NM_001536.5	559	Missense Mutation	CGG,GGG	R144G	NP_001527.3
NM_198318.4	559	Missense Mutation	CGG,GGG	R126G	NP_938074.2

View Full Product Details