Product Details

SNP ID: rs58164562
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:110904356 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TAGAATAAGGAGAGAAACAACAGCA[C/T]GCCAGAAGGTGGTAAGAACTATAGA
Phenotype: MIM: 613605 MIM: 608610
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: BBIP1 PubMed Links

Gene Details

Gene: BBIP1
Gene Name: BBSome interacting protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195304.1		Intron			NP_001182233.1
NM_001195305.1		Intron			NP_001182234.1
NM_001195306.1		Intron			NP_001182235.1
NM_001195307.1		Intron			NP_001182236.1
NM_001243783.1		Intron			NP_001230712.1

Gene: MIR4680
Gene Name: microRNA 4680

There are no transcripts associated with this gene.

Gene: PDCD4
Gene Name: programmed cell death 4 (neoplastic transformation inhibitor)

There are no transcripts associated with this gene.

View Full Product Details